Top » Catalog » SNPs » A1328

$18.00

A1328
[A1328]

A1328
hg38 Position: ChrY:2783609..2783609
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2 (not listed)
Comments: Below Y4882 and parallel to A811
Forward Primer: A1328v2_F GAATTGCAAAAGGGCACAG
Reverse Primer: A1328v2_R ATTAGGCATTGAAGTGGGTAATG
Reviews

Customers who bought this product also purchased
Y141127
Y141127
Y100616
Y100616
Z17855
Z17855
BY106777
BY106777
A5877
A5877
A14359
A14359
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies