Top » Catalog » SNPs » A1330

$18.00

A1330
[A1330]

A1330
hg38 Position: ChrY:11881166..11881166
Ancestral: C
Derived: T
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1a1a1 (not listed)
Comments: Downstream DF97
Forward Primer: A1330_F ACTCACTGAACTGATGCTTCCTC
Reverse Primer: A1330_R TAAAATTTTCATCATAAAAACTGGCAG
Reviews

Customers who bought this product also purchased
A4697
A4697
FGC12184
FGC12184
A2204
A2204
FGC35551
FGC35551
A1147
A1147
FGC19845
FGC19845
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies