Top » Catalog » SNPs » A1331

$18.00

A1331
[A1331]

A1331
hg38 Position: ChrY:21819478..21819478
Ancestral: C
Derived: T
Reference: Iain Kennedy (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1a1a1 (not listed)
Comments: Downstream DF97
Forward Primer: A1331_F CAATGTGGCTGCTAATGTTGTG
Reverse Primer: A1331_R CCTTTTCCTAAAGTCCAAGTTCC
Reviews

Customers who bought this product also purchased
A1330
A1330
A1332
A1332
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies