Top » Catalog » SNPs » A1342

$18.00

A1342
[A1342]

A1342
hg38 Position: ChrY:15554426..15554426
Ancestral: G
Derived: T
Reference: James Kane (2014)
ISOGG Haplogroup: R1b1a2a1a2c1c2 (not listed)
Comments: Downstream of Z16254 > A1338
Forward Primer: A1342_F GATCACTTGGCAGCTTTTCC
Reverse Primer: A1342_R TTCATGTGCCTACATTTTGTACTTATG
Reviews

Customers who bought this product also purchased
FGC11858
FGC11858
A1338
A1338
A1337
A1337
FGC1180
FGC1180
A1336
A1336
A1341
A1341
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies