Top » Catalog » SNPs » CTS4089

$18.00

CTS4089
[CTS4089]

CTS4089
hg38 Position: ChrY:13278495..13278495
Ancestral: C
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: not listed
Comments: Syn. with CTS4089; downstream CTS11457
Forward Primer: CTS4089_F TTTGAGGAAAGGAGAGGGAAG
Reverse Primer: CTS4089_R ATGCCACCTGAGAGACAAGG
Reviews

Customers who bought this product also purchased
Y16563
Y16563
CTS9334
CTS9334
M96
M96
FGC62866
FGC62866
PH2818
PH2818
Y16536
Y16536
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies