Top » Catalog » SNPs » CTS4089

$18.00

CTS4089
[CTS4089]

CTS4089
hg38 Position: ChrY:13278495..13278495
Ancestral: C
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: not listed
Comments: Syn. with CTS4089; downstream CTS11457
Forward Primer: CTS4089_F TTTGAGGAAAGGAGAGGGAAG
Reverse Primer: CTS4089_R ATGCCACCTGAGAGACAAGG
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
FT139512
FT139512
V22
V22
CTS6080
CTS6080
FGC92599
FGC92599
Z834
Z834
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies