Top » Catalog » SNPs » S1688

$18.00

S1688
[S1688]

S1688
hg38 Position: ChrY:20953587..20953587
Ancestral: C
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2a
Comments: Downstream of Z301 and upstream of U198.
Forward Primer: S1688_F CCTGCTTATTTCCCTGAGCTG
Reverse Primer: S1688_R GTGGCCAGGAGACCAATAAC
Reviews

Customers who bought this product also purchased
S22165
S22165
M269
M269
Y146163
Y146163
Z2103
Z2103
FGC19756
FGC19756
M201
M201
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies