Top » Catalog » SNPs » YP1137

$18.00

YP1137
[YP1137]

YP1137
hg38 Position: ChrY:7189182..7189182
Ancestral: A
Derived: G
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP1137v2_F CCACAGCAAGACACTTGTTTACAC
Reverse Primer: YP1137v2_R GTTAGAAGGTGACTTATTCCATGTTG
Reviews

Customers who bought this product also purchased
Y42120
Y42120
Y28874
Y28874
Y42176
Y42176
Y144485
Y144485
BY30629
BY30629
A14777
A14777
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies