Top » Catalog » SNPs » YP1137

$18.00

YP1137
[YP1137]

YP1137
hg38 Position: ChrY:7189182..7189182
Ancestral: A
Derived: G
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP1137v2_F CCACAGCAAGACACTTGTTTACAC
Reverse Primer: YP1137v2_R GTTAGAAGGTGACTTATTCCATGTTG
Reviews

Customers who bought this product also purchased
YP592
YP592
Y37930
Y37930
Y18348
Y18348
YP6047
YP6047
M12418
M12418
YP619
YP619
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies