Top » Catalog » SNPs » YP1137

$18.00

YP1137
[YP1137]

YP1137
hg38 Position: ChrY:7189182..7189182
Ancestral: A
Derived: G
Reference: R1a community
ISOGG Haplogroup: R1a (not listed)
Comments: .
Forward Primer: YP1137v2_F CCACAGCAAGACACTTGTTTACAC
Reverse Primer: YP1137v2_R GTTAGAAGGTGACTTATTCCATGTTG
Reviews

Customers who bought this product also purchased
Y39054
Y39054
Y139228
Y139228
Y96582
Y96582
BY82741
BY82741
Y70897
Y70897
FT104863
FT104863
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies