Top » Catalog » SNPs » FGC11858

$19.00

FGC11858
[FGC11858]

FGC11858
hg38 Position: ChrY:15799108..15799108
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC11858v2_F ATTTAGCAATGCCATGTTGTATTC
Reverse Primer: FGC11858v2_R TCCTCCTCTTCCACATCTTCTC
Reviews

Customers who bought this product also purchased
A1338
A1338
A1337
A1337
A1342
A1342
A1336
A1336
A1341
A1341
A1340
A1340
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies