Top » Catalog » SNPs » A16

$18.00

A16
[A16]

A16
hg38 Position: ChrY:11928801..11928801
Ancestral: T
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1f2b
Comments: Found in a R1b-Z253 person
Forward Primer: A16_F CCCTGTGTCATCCTTTCTCC
Reverse Primer: A16_R GCCAGTGATGGATACAGAAGC
Reviews

Customers who bought this product also purchased
BY13693
BY13693
A10499
A10499
Z255
Z255
Z39589
Z39589
FGC41901
FGC41901
Z2195
Z2195
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies