Top » Catalog » SNPs » FGC14559

$18.00

FGC14559
[FGC14559]

FGC14559
hg38 Position: ChrY:12718935..12718935
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: Below V13. approx. L1019
Forward Primer: FGC14559_F GAGCTACCATACCGCATAGTTTG
Reverse Primer: FGC14559_R TTGAAAAGTATGTCTGGAAGAGGAC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies