Top » Catalog » SNPs » FGC14560

$18.00

FGC14560
[FGC14560]

FGC14560
hg38 Position: ChrY:14221228..14221228
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: Below V13. approx. L1019
Forward Primer: FGC14560v2_F TGTCCCTCAATTTACATGAATCC
Reverse Primer: FGC14560v2_R GGTATATCTGAACATCCACTTACATTTG
Reviews

Customers who bought this product also purchased
E1b-L1019 Goodrich Panel
E1b-L1019 Goodrich Panel
Z5018
Z5018
Z16242
Z16242
L1019
L1019
FGC14570
FGC14570
YFS287726
YFS287726
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies