Top » Catalog » SNPs » FGC14566

$18.00

FGC14566
[FGC14566]

FGC14566
hg38 Position: ChrY:19227295..19227295
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: Below V13. approx. L1019
Forward Primer: FGC14566_F ACCACACCTGGCACAATATG
Reverse Primer: FGC14566_R CTTCTCAGTCTCTAGCAACCAGC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies