Top » Catalog » SNPs » FGC19295

$18.00

FGC19295
[FGC19295]

FGC19295
hg38 Position: ChrY:15500348..15500348
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: E (not listed)
Comments: Aka YFS153876
Forward Primer: FGC19295_F CTTTTTCTGGGTGCTGTGG
Reverse Primer: FGC19295_R GGGGCTAAACAACTTCATACTCTG
Reviews

Customers who bought this product also purchased
E1b-L1019 Goodrich Panel
E1b-L1019 Goodrich Panel
Z5018
Z5018
Z16242
Z16242
L1019
L1019
FGC14562
FGC14562
YFS153796
YFS153796
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies