Top » Catalog » SNPs » FGC19306

$18.00

FGC19306
[FGC19306]

FGC19306
hg38 Position: ChrY:6888698..6888698
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: Below V13. approx. L1019
Forward Primer: FGC19306v2_F TCTGCTGTTTGATGGAAAATTG
Reverse Primer: FGC19306v2_R AGTGCAGGGGCACTACCTC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies