Top » Catalog » SNPs » FGC19309

$18.00

FGC19309
[FGC19309]

FGC19309
hg38 Position: ChrY:14359512..14359512
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: Below V13. approx. L1019
Forward Primer: FGC19309_F GCTGCCTGTGGGTGTACATC
Reverse Primer: FGC19309_R TGGTGCCATGACCCAGAC
Reviews

Customers who bought this product also purchased
Z5018
Z5018
Z16242
Z16242
L1019
L1019
E1b-L1019 Goodrich Panel
E1b-L1019 Goodrich Panel
FGC14554
FGC14554
FGC19295
FGC19295
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies