Top » Catalog » SNPs » FGC19314

$18.00

FGC19314
[FGC19314]

FGC19314
hg38 Position: ChrY:17418626..17418626
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: Below V13. approx. L1019
Forward Primer: FGC19314v2_F GCTGGAGTGCAGTGGTGC
Reverse Primer: FGC19314v2_R GCCTTTTGAAAAAGGACAACC
Reviews

Customers who bought this product also purchased
Z16242
Z16242
L1019
L1019
E1b-L1019 Goodrich Panel
E1b-L1019 Goodrich Panel
Z5018
Z5018
FGC14558
FGC14558
FGC19310
FGC19310
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies