Top » Catalog » SNPs » FGC19315

$18.00

FGC19315
[FGC19315]

FGC19315
hg38 Position: ChrY:19057778..19057778
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: Below V13. approx. L1019
Forward Primer: FGC19315v2_F TTAGTTGGTGAAGATGAAAGCTCC
Reverse Primer: FGC19315v2_R GCTGGAGTGCTGTGGTACC
Reviews

Customers who bought this product also purchased
L1019
L1019
E1b-L1019 Goodrich Panel
E1b-L1019 Goodrich Panel
Z5018
Z5018
Z16242
Z16242
FGC14570
FGC14570
YFS287756
YFS287756
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies