Top » Catalog » SNPs » A19

$18.00

A19
[A19]

A19
hg38 Position: ChrY:12240306..12240306
Ancestral: T
Derived: C
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1f~
Comments: Aka S847; found in a R1b-Z253 person
Forward Primer: A19_F AATGATTCACTTTGATATTTCTGTCTC
Reverse Primer: A19_R TCCTTAGCATCAAGGAATGC
Reviews

Customers who bought this product also purchased
A17
A17
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies