Top » Catalog » SNPs » A1366

$18.00

A1366
[A1366]

A1366
hg38 Position: ChrY:26463748..26463748
Ancestral: A
Derived: G
Reference: William Hartley (2014)
ISOGG Haplogroup: I1a2a1a (not listed)
Comments: Downstream Z140 F2642 Y1884/S2158
Forward Primer: A1366v2_F GATTTTAGGCTCCCATCACTG
Reverse Primer: A1366v2_R GAGGAAAGATTTTTTTATAGATCGAGG
Reviews

Customers who bought this product also purchased
A1365
A1365
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies