Top » Catalog » SNPs » FGC4284

$18.00

FGC4284
[FGC4284]

FGC4284
hg38 Position: ChrY:12110253..12110253
Ancestral: C
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC4284v2_F GTTTAATGGACTCACAGTTCCATG
Reverse Primer: FGC4284v2_R AAGGAAGGGTCCCCGAG
Reviews

Customers who bought this product also purchased
FGC4286
FGC4286
FGC4298
FGC4298
FGC4278
FGC4278
FGC4295
FGC4295
FGC4293
FGC4293
FGC4289
FGC4289
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies