Top » Catalog » SNPs » A33

$18.00

A33
[A33]

A33
hg38 Position: ChrY:13423153..13423153
Ancestral: T
Derived: C
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k (not listed)
Comments: Found in a R1b-L1335 person
Forward Primer: A33_F TCAGGACCCATCTCAAAATTC
Reverse Primer: A33_R GCTTGTTCTGCTGACACTGC
Reviews

Customers who bought this product also purchased
Z39589
Z39589
FGC32994
FGC32994
DF13
DF13
BY3144
BY3144
S9767
S9767
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies