Top » Catalog » SNPs » A34

$18.00

A34
[A34]

A34
hg38 Position: ChrY:15166626..15166626
Ancestral: A
Derived: G
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a2a1a2c1k (not listed)
Comments: Found in a R1b-L1335 person
Forward Primer: A34_F GAGAGAAAGAAAGCTGAACACAG
Reverse Primer: A34_R GGGGGTCTTGTTTTTCTAGATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies