Top » Catalog » SNPs » Y6231

$18.00

Y6231
[Y6231]

Y6231
hg38 Position: ChrY:26655792..26655792
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: Y6231_F AAGGAGTAGAGTGGAATGGAATGTAC
Reverse Primer: Y6231_R TTCATTCAATTTGATTCCATGTG
Reviews

Customers who bought this product also purchased
A196
A196
Y6233
Y6233
DNA Sample Kit
DNA Sample Kit
DNA Extraction
DNA Extraction
A1471
A1471
Y7277
Y7277
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies