Top » Catalog » SNPs » Y6231

$18.00

Y6231
[Y6231]

Y6231
hg38 Position: ChrY:26655792..26655792
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: Y6231_F AAGGAGTAGAGTGGAATGGAATGTAC
Reverse Primer: Y6231_R TTCATTCAATTTGATTCCATGTG
Reviews

Customers who bought this product also purchased
Z58
Z58
S1953
S1953
Z141
Z141
I1 Superclade Panel
I1 Superclade Panel
I1-Z140 Panel
I1-Z140 Panel
A1374
A1374
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies