Top » Catalog » SNPs » Y6231

$18.00

Y6231
[Y6231]

Y6231
hg38 Position: ChrY:26655792..26655792
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: Y6231_F AAGGAGTAGAGTGGAATGGAATGTAC
Reverse Primer: Y6231_R TTCATTCAATTTGATTCCATGTG
Reviews

Customers who bought this product also purchased
S1990
S1990
Z2041
Z2041
Z138
Z138
FT2885
FT2885
A1994
A1994
BY477
BY477
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies