Top » Catalog » SNPs » Y6231

$18.00

Y6231
[Y6231]

Y6231
hg38 Position: ChrY:26655792..26655792
Ancestral: G
Derived: A
Reference: Yfull (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: Y6231_F AAGGAGTAGAGTGGAATGGAATGTAC
Reverse Primer: Y6231_R TTCATTCAATTTGATTCCATGTG
Reviews

Customers who bought this product also purchased
A1601
A1601
Z62
Z62
F2642
F2642
Z58
Z58
S1953
S1953
Z141
Z141
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies