Top » Catalog » SNPs » Y6233

$18.00

Y6233
[Y6233]

Y6233
hg38 Position: ChrY:19833993..19833993
Ancestral: C
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: Y6233_F CAAGGGTGTCAGGGAAGATG
Reverse Primer: Y6233_R AATAAATAAATAAATGCTTCTTTGACTGG
Reviews

Customers who bought this product also purchased
Y6231
Y6231
DNA Sample Kit
DNA Sample Kit
DNA Extraction
DNA Extraction
A196
A196
Y6232
Y6232
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies