Top » Catalog » SNPs » A40

$18.00

A40
[A40]

A40
hg38 Position: ChrY:8231047..8231047
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5
Comments: Found in a R1b-DF41 person
Forward Primer: A40_F GGAAAGGAGACACCTGGAAATG
Reverse Primer: A40_R TGCAGAATTTGGGCTGTTATATG
Reviews

Customers who bought this product also purchased
FGC11134
FGC11134
Y5641
Y5641
L513
L513
A875
A875
Z253
Z253
FGC5494
FGC5494
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies