Top » Catalog » SNPs » A40

$18.00

A40
[A40]

A40
hg38 Position: ChrY:8231047..8231047
Ancestral: G
Derived: A
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5
Comments: Found in a R1b-DF41 person
Forward Primer: A40_F GGAAAGGAGACACCTGGAAATG
Reverse Primer: A40_R TGCAGAATTTGGGCTGTTATATG
Reviews

Customers who bought this product also purchased
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
FGC11134
FGC11134
Y5641
Y5641
L513
L513
A875
A875
Z253
Z253
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies