Top » Catalog » SNPs » FGC18842

$18.00

FGC18842
[FGC18842]

FGC18842
hg38 Position: ChrY:15053731..15053731
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b1a2a1a1c2b2b1a
Comments: Downstream Z326
Forward Primer: FGC18842_F CTGCTTCAGCTCGCACAG
Reverse Primer: FGC18842_R GCAACTGTAGCTTTGTTGTTAAGC
Reviews

Customers who bought this product also purchased
BY5719
BY5719
Z301
Z301
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
S268
S268
Z381
Z381
Y67920
Y67920
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies