Top » Catalog » SNPs » L791

$18.00

L791
[L791]

L791
hg38 Position: ChrY:12116173..12116173
Ancestral: A
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: E1b1b1b2a1a4
Comments: Found in a hg E-M34 WTY participant. Below Y2933.
Forward Primer: L791_F CACAGAGGGACAACCACCTG
Reverse Primer: L791_R CTTCCAACAGGGTGCCC
Reviews

Customers who bought this product also purchased
Y4971
Y4971
E Superclade Panel
E Superclade Panel
L795
L795
E1b-Z834 Panel
E1b-Z834 Panel
Y21111
Y21111
Z825
Z825
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies