Top » Catalog » SNPs » L791

$18.00

L791
[L791]

L791
hg38 Position: ChrY:12116173..12116173
Ancestral: A
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: E1b1b1b2a1a4
Comments: Found in a hg E-M34 WTY participant. Below Y2933.
Forward Primer: L791_F CACAGAGGGACAACCACCTG
Reverse Primer: L791_R CTTCCAACAGGGTGCCC
Reviews

Customers who bought this product also purchased
Y21111
Y21111
Z825
Z825
YP5379
YP5379
Z834
Z834
Y2933
Y2933
M215
M215
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies