Top » Catalog » SNPs » M269

$18.00

M269
[M269]

M269
hg38 Position: ChrY:20577481..20577481
Ancestral: T
Derived: C
Reference: Underhill et al.
ISOGG Haplogroup: R1b1a1a2
Comments: .
Forward Primer: M269_F TCTCCCTTTGCAAAATGTCC
Reverse Primer: M269_R TGCCTTCTGAGGCACATATG
Reviews

Customers who bought this product also purchased
M172
M172
A555
A555
DF49
DF49
S11556
S11556
FGC65747
FGC65747
DF21
DF21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies