Top » Catalog » SNPs » M269

$18.00

M269
[M269]

M269
hg38 Position: ChrY:20577481..20577481
Ancestral: T
Derived: C
Reference: Underhill et al.
ISOGG Haplogroup: R1b1a1a2
Comments: .
Forward Primer: M269_F TCTCCCTTTGCAAAATGTCC
Reverse Primer: M269_R TGCCTTCTGAGGCACATATG
Reviews

Customers who bought this product also purchased
Y83965
Y83965
Y36979
Y36979
Z2105
Z2105
Z2109
Z2109
Y101118
Y101118
Z255
Z255
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies