Top » Catalog » SNPs » A1487

$18.00

A1487
[A1487]

A1487
hg38 Position: ChrY:7123495..7123495
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1487_F TCAATGGGCTATTGGTCCTC
Reverse Primer: A1487_R TCCCTGCTTTGTCTCTCCTC
Reviews

Customers who bought this product also purchased
A1488
A1488
A23669
A23669
A1496
A1496
A1506
A1506
A18396
A18396
FT12974
FT12974
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies