Top » Catalog » SNPs » A1488

$18.00

A1488
[A1488]

A1488
hg38 Position: ChrY:7944675..7944675
Ancestral: G
Derived: C
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1488vl_F GCAAAGCCACATCACATAGG
Reverse Primer: A1488vl_R GCCATAGGTGGGCTGGTG
Reviews

Customers who bought this product also purchased
A1490
A1490
A1487
A1487
R1b-FGC5494 Panel
R1b-FGC5494 Panel
FT12974
FT12974
A23669
A23669
A18396
A18396
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies