Top » Catalog » SNPs » A1503

$19.00

A1503
[A1503]

A1503
hg38 Position: ChrY:19261456..19261456
Ancestral: C
Derived: T
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1503_F TCCACAGCTTCACTCAGGTG
Reverse Primer: A1503_R GGGCCTCTTACCTTTGGTTC
Reviews

Customers who bought this product also purchased
A1506
A1506
A1496
A1496
A1502
A1502
A1495
A1495
A1501
A1501
BY23977
BY23977
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies