Top » Catalog » SNPs » A1504

$18.00

A1504
[A1504]

A1504
hg38 Position: ChrY:19262629..19262629
Ancestral: A
Derived: G
Reference: Mark Jost (2014)
ISOGG Haplogroup: R1b1a2a1a2c1l (not listed)
Comments: Downstream FGC5494
Forward Primer: A1504_F ATGGCTGCCTCTTTAGCTTG
Reverse Primer: A1504_R TCTGGATGCAATTTGGTTTTC
Reviews

Customers who bought this product also purchased
A1489
A1489
A1499
A1499
A1497
A1497
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies