Top » Catalog » SNPs » Z27232

$18.00

Z27232
[Z27232]

Z27232
hg38 Position: ChrY:13609321..13609321
Ancestral: A
Derived: G
Reference: Ray Banks (2014)
ISOGG Haplogroup: G2a2b2a1a1c1a2a1
Comments: .
Forward Primer: Z27232_F AATTCTTCAAGATTGGCTTATAGTCAC
Reverse Primer: Z27232_R GATTTTTTCAAGGGGAGGACAC
Reviews

Customers who bought this product also purchased
FGC58720
FGC58720
CTS7045
CTS7045
G2a-L1259 Panel
G2a-L1259 Panel
CTS342
CTS342
mtUpgrade
mtUpgrade
HU1
HU1
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies