Top » Catalog » SNPs » Z6028

$18.00

Z6028
[Z6028]

Z6028
hg38 Position: ChrY:7459309..7459309
Ancestral: C
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: G2a2b2a1a1c1a2a1
Comments: .
Forward Primer: Z6028_F GGGGCTTCAGTTCTTTCCAG
Reverse Primer: Z6028_R TTTGGCTTGTTCATCCTCTC
Reviews

Customers who bought this product also purchased
L140
L140
FGC251
FGC251
U8
U8
Z724
Z724
G2a-L1259 Panel
G2a-L1259 Panel
CTS342
CTS342
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies