Top » Catalog » SNPs » Z6028

$18.00

Z6028
[Z6028]

Z6028
hg38 Position: ChrY:7459309..7459309
Ancestral: C
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: G2a2b2a1a1c1a2a1
Comments: .
Forward Primer: Z6028_F GGGGCTTCAGTTCTTTCCAG
Reverse Primer: Z6028_R TTTGGCTTGTTCATCCTCTC
Reviews

Customers who bought this product also purchased
U1
U1
L497
L497
FGC31715
FGC31715
L140
L140
FGC251
FGC251
U8
U8
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies