Top » Catalog » SNPs » A47

$18.00

A47
[A47]

A47
hg38 Position: ChrY:17211675..17211675
Ancestral: G
Derived: T
Reference: Thomas Krahn (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i5~
Comments: Found in a R1b-DF41 person
Forward Primer: A47_F CAGCCCACTGCCAGTGTG
Reverse Primer: A47_R TTATTATTACTTTTGCATCACCCTAGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies