Top » Catalog » SNPs » Z3428

$18.00

Z3428
[Z3428]

Z3428
hg38 Position: ChrY:17414413..17414413
Ancestral: C
Derived: T
Reference: Ray Banks (2013)
ISOGG Haplogroup: G2a2b2a1a1c1a2
Comments: Appox. Hg: G-Z1903. aka Y66
Forward Primer: Z3428_F GGTCTCCTCTACTAGGGTTTAATC
Reverse Primer: Z3428_R TGAACCCAAGCCACCACTGC
Reviews

Customers who bought this product also purchased
CTS7045
CTS7045
U8
U8
FGC31708
FGC31708
mtUpgrade
mtUpgrade
FGC31715
FGC31715
FGC251
FGC251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies