Top » Catalog » SNPs » Y4751

$18.00

Y4751
[Y4751]

Y4751
hg38 Position: ChrY:16523842..16523842
Ancestral: A
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1a1a1a1a
Comments: Found in BIGY and is in the area of Y4750. aka FGC20065
Forward Primer: Y4751_F CTAAAACATCCCTAGGCAGGG
Reverse Primer: Y4751_R TCTGTCTCATCACTTCAGCAAAAC
Reviews

Customers who bought this product also purchased
Y36594
Y36594
FT151543
FT151543
BY136377
BY136377
BY60810
BY60810
Y4750
Y4750
DF105
DF105
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies