Top » Catalog » SNPs » M165

$18.00

M165
[M165]

M165
hg38 Position: ChrY:19704789..19704789
Ancestral: A
Derived: G
Reference: Underhill et al. 2001
ISOGG Haplogroup: E1b1b1b1a1a
Comments: B9.008c
Forward Primer: M165_F CGAGAGATTCAATCCAGGATG
Reverse Primer: M165_R TGTGGCCAGATCACAATGTC
Reviews

Customers who bought this product also purchased
BY198035
BY198035
E1b-L19 Panel
E1b-L19 Panel
MF4289
MF4289
PF6789
PF6789
A5604
A5604
Z27803
Z27803
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies