Top » Catalog » SNPs » M165

$18.00

M165
[M165]

M165
hg38 Position: ChrY:19704789..19704789
Ancestral: A
Derived: G
Reference: Underhill et al. 2001
ISOGG Haplogroup: E1b1b1b1a1a
Comments: B9.008c
Forward Primer: M165_F CGAGAGATTCAATCCAGGATG
Reverse Primer: M165_R TGTGGCCAGATCACAATGTC
Reviews

Customers who bought this product also purchased
PF6789
PF6789
A5604
A5604
Z27803
Z27803
MZ99
MZ99
M5343
M5343
PF6794
PF6794
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies