Top » Catalog » SNPs » M165

$18.00

M165
[M165]

M165
hg38 Position: ChrY:19704789..19704789
Ancestral: A
Derived: G
Reference: Underhill et al. 2001
ISOGG Haplogroup: E1b1b1b1a1a
Comments: B9.008c
Forward Primer: M165_F CGAGAGATTCAATCCAGGATG
Reverse Primer: M165_R TGTGGCCAGATCACAATGTC
Reviews

Customers who bought this product also purchased
PF6794
PF6794
MZ90
MZ90
MZ117
MZ117
Y109169
Y109169
M5043
M5043
MZ3
MZ3
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies