Top » Catalog » SNPs » FGC5521

$18.00

FGC5521
[FGC5521]

FGC5521
hg38 Position: ChrY:12751608..12751608
Ancestral: T
Derived: C
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person. downstream of FGC5496
Forward Primer: FGC5521_F TGGAGTTTTTGGTGAAATGC
Reverse Primer: FGC5521_R CCTTTCACAAAATGGTTCTGG
Reviews

Customers who bought this product also purchased
YFS444718
YFS444718
Z39589
Z39589
FGC43417
FGC43417
A117
A117
PF5191
PF5191
L371
L371
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies