Top » Catalog » SNPs » FGC5521

$18.00

FGC5521
[FGC5521]

FGC5521
hg38 Position: ChrY:12751608..12751608
Ancestral: T
Derived: C
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person. downstream of FGC5496
Forward Primer: FGC5521_F TGGAGTTTTTGGTGAAATGC
Reverse Primer: FGC5521_R CCTTTCACAAAATGGTTCTGG
Reviews

Customers who bought this product also purchased
MC14
MC14
CTS3386
CTS3386
S1090
S1090
BY203693
BY203693
S1105
S1105
A194
A194
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies